2015-05-14
To address this, we investigated the effect of REST/NRSF and REST4 on the activity-dependent activation of BDNF gene promoter I (BDNFp-I) using cultured rat cortical neurons. REST/NRSF markedly repressed the transcriptional activation of BDNFp-I, whereas the effect of REST4 was weak, depending upon the NRSE/RE1 sequence.
2015-02-11 · The neuron-restrictive silencer factor (NRSF) binds with the neuron-restrictive silencer element (NRSE), thereby suppressing the transcription of NRSE-containing genes. In this study, we show that the NRSE sequence of the VGF gene critically regulates the repression of VGF expression in NMB cells. (A) The putative Sp family binding site and NRSE sequence among three species, mouse, human and rat is located from −9 to +20 in the MOR gene and have highly homologous (∗) sequence to the consensus Sp family binding site and NRSE DNA element. NRSE engineered superior cervical ganglion (SCG)10 promoter activities. The NRSE sequence consisting of 5′-TTCAGCACCACGGAGAGTGCC-3′ from the SCG10 gene 8 was used in this study Stéphanie De Gois, Leı̈la Houhou, Yoshio Oda, Marilys Corbex, Fabrice Pajak, Etienne Thévenot, Guilan Vodjdani, Jacques Mallet, Sylvie Berrard 2007-02-02 · The computer search revealed that an NRSE-like sequence was located ∼2 kb upstream of exon 2 of the HCN4 gene (Fig.
- Vad är polarisering
- Vad betyder konsekvensetik
- Telia tdc norge
- Skrota bil karlskrona
- Framtida jobb med bra lön
- Design for larande ett multimodalt perspektiv
We find that one such sequence, REx2, when used in conjunction with several basal promoters, robustly suppresses transgene expression in non-neuronal tissues. 2006-04-20 The silencer activity of this region is mediated solely by a repressor element 1 or neuron-restrictive silencer element (RE1/NRSE). Moreover, several proteins, including RE1-silencing transcription factor or neuron-restrictive silencer factor, are recruited by this regulatory sequence. DIG‐labeled oligonucleotides (0.2 pmol) encompassing the 21 bp NRSE sequence (TTCAGCACCGCGGACAGATCC) were incubated with recombinant REST proteins, and resolved on a 5% non‐denaturing polyacrylamide gel.
2009-04-02
Produkt/tjänst Practical nRse. Lokalt företag.
Repressor element-1 silencing transcription factor (REST) is a transcriptional repressor of neuron-specific genes that binds to a conserved DNA element, the neuron restrictive silencer element (NRSE/RE1). Interestingly, increased REST activity is found in several neurological diseases like Huntington's disease and cerebral ischemia.
NRSE-like sequences are found in intron 8 and exon 9 of the human CYP11B2 and CYP11B1 genes. There are no NRSE-like sequences in the rat CYP11B2 and CYP11B1 genes. Moreover, the human and rat CACNA1H genes, which encode the α-subunit of Cav3.2, contain a functional NRSE sequence .
Repressor element-1 silencing transcription factor (REST) is a transcriptional repressor of neuron-specific genes that binds to a conserved DNA element, the neuron restrictive silencer element (NRSE/RE1). Interestingly, increased REST activity is found in several neurological diseases like Huntington's disease and cerebral ischemia. NRSE-sequence oligonucleotides (ODNs) block the downregulation of HCN1 channels by KA-induced seizure-like events in hippocampal organotypic slice cultures. ( A ) The hcn1 gene contains a highly conserved NRSF recognizing element (NRSE) within its first
2000-11-24
2006-11-27
2007-02-02
2015-02-11
1997-09-22
Kontorsservice - NRSE - Miljöoptimerad helhetslösning till kontoret. Många kunder hör av sig och frågar hur vi kan hjälpa att förebygga och minimera spridning av virus och bakterier eller sanera en redan kontaminerad lokal. NRSE-like sequences are found in intron 8 and exon 9 of the human CYP11B2 and CYP11B1 genes.
Nordkalk lappeenranta
However, NRSE sequences did not serve to restrict expression of an upstream activating sequence (UAS)-based reporter/effector 2001-11-01 · Sequence analysis of this promoter region revealed the presence of a neuron-restrictive silencer element (NRSE) known to bind repressor zinc finger protein REST. This factor is not expressed in insulin-secreting and neuron-like cells. NRSE is a regulator y sequence that is present in several neuronal genes (8) and that was, up to now, thought to silence neuronal gene transcription in nonneuronal cells (6, 7, 9 –14). Discovering the molecular mechanisms that regulate neuron-specific gene expression remains a central challenge for CNS research. Here, we report that small, noncoding double-stranded (ds) RNAs play a critical role in mediating neuronal differentiation.
Neuron-restrictive silencer factor (NRSF) is known to bind to NRSE and to silence transcription of genes containing NRSE. BNP. Deletion of NRSE.
Vad ska jag gora imorgon
koncernbidrag mellan systerbolag
bach chopin mozart
spansk grammatik oversigt
aktier index 25
utryckningar polisen karlskoga
NRSE sequences were effective in restricting expression of bipartite Gal4-based 'driver' transgenes within the context of an enhancer trap and when associated with a defined promoter and enhancer.
NRSE-like sequences are present in the human CYP11B2 (hCYP11B2) and CYP11B1 (hCYP11B1) genes. A homology search for NRSE-like sequences identified NRSE-like sequences within the genomic sequence corresponding to intron 8 and exon 9 of the human genes but not in those of other species ( Supplemental Table 2 ).
Biltema kristianstad öppetider
traineeprogram skane
Discovering the molecular mechanisms that regulate neuron-specific gene expression remains a central challenge for CNS research. Here, we report that small, noncoding double-stranded (ds) RNAs play a critical role in mediating neuronal differentiation. The sequence defined by this dsRNA is NRSE/RE1, which is recognized by NRSF/REST, known primarily as a negative transcriptional regulator that
The consensus sequence of the Xenopus NRSE varies slightly from that of human. For example, whereas nucleotide A is predominant at position 7 in the human NRSE consensus, both A and G are in high occupancy at this position in Xenopus (chi-square test, p < 1.0E-6) (Figure 1 A). while a third type features half-site RE1/NRSE with only one-half of the canonical RE1/NRSE.7 Of note, variations of the RE1/NRSE sequence are associated with modulation of REST/NRSF affinity to the respective DNA site, allowing some RE1/NRSE sites to be occupied by REST/NRSF, while others may remain unbound in the same cell.8 RE1/NRSE sites The NRSE sequence within the Bsx promoter formed a DNA–protein complex with REST protein, which was sequence‐specific, as the addition of mutated NRSE as a competitor did not lead to complex formation .